2024•PLoS ONEOpen access

Correction: Anti-inflammatory effects of cold atmospheric plasma irradiation on the THP-1 human acute monocytic leukemia cell line

Ito Hirasawa, Haruka Odagiri, Giri Park, Rutvi Sanghavi, Takaya Oshita, Akiko Togi, Katsunori Yoshikawa, Koji Mizutani, Yasuo Takeuchi, Hiroaki Kobayashi, Sayaka Katagiri, Takanori Iwata, Akira Aoki

Open full text 1 citations

Abstract

In the Table 1, the primer sequences of the forward (GCTGATGGCCCTAAACAGA) and reverse (GGTGGTCGGAGATTCGTAG) for IL6 are incorrect.The correct sequences for IL6 are as follows: forward (CCACTCACCTCTTCAGAACG) and reverse (CATCTTTGGAAGG TTCAGGTTG).Please see the correct Table 1 here.

Open-access reader

About this research paper

What this paper is about

Why it matters

OpenAlex reports 1 citations for this work. Citation counts describe recorded attention and do not establish research quality.

Key contribution

A contribution statement is not available in the OpenAlex record.

Method / approach

Method details are not available in the OpenAlex metadata.

Main findings

Findings are not separately available in the OpenAlex metadata.

Limitations

Limitations are not available in the OpenAlex metadata.

Applications

Application details are not available in the OpenAlex metadata.

Available abstract

Key concepts: THP1 cell line, Monocytic leukemia, Acute monocytic leukemia, Leukemia, Cell culture, Acute leukemia, Medicine, Biology