Limits of Detection of 6 Approved RT–PCR Kits for the Novel SARS-Coronavirus-2 (SARS-CoV-2)

To the Editor: The novel SARS-coronavirus 2 (SARS-CoV-2, previously 2019-nCoV) can cause lethal coronavirus disease 2019 (COVID-19) (1,). Since its outbreak in December 2019, COVID-19 has posed a great threat to human health and life in China and the world (2,). Nucleic acid testing is the gold standard method for confirming infection (3,). Many real-time reverse transcription-PCR (RT–PCR) kits have been developed and used by the World Health Organization, the United States Centers for Disease Control and Prevention, the Chinese Center for Disease Control and Prevention, and private companies. However, in China, false-negative results have been reported at rates as high as 20 to 40% in cases for which both clinical symptoms and imaging evidence raised strong suspicions of disease (4). False negatives may be caused by various factors, including the specimen source, timing of sampling, personnel operation, and the test kit quality. The limit of detection (LoD), the lowest analyte concentration that a kit can detect, is an important performance parameter in evaluating kit quality. To cope with the COVID-19 epidemic, the China National Medical Products Administration (NMPA) approved 6 RT–PCR kits for SARS-CoV-2, some of which subsequently received CE (Conformité Européenne) marking. However, because the research and development time was short, the approved kits were not verified or optimized with appropriate numbers of clinical samples, which may have affected their LoDs. To examine whether LoD is a factor contributing to the observed false-negative results, we evaluated and compared the LoDs of these 6 kits using real viral RNA. Viral RNA was extracted from cultured SARS-CoV-2 (SARS-CoV-2/ZJU-01/Human/2020) with the QIAamp Viral RNA Mini Kit (Qiagen). To verify its applicability, the viral RNA was tested with the 6 kits provided by Shanghai Liferiver Bio-tech Co., Ltd, Wuhan Huada Bio-tech Co., Ltd, Shanghai GeneoDx Biotech Co., Ltd, DAAN Gene Co., Ltd of Sun Yat-sen University, Sansure Biotech Inc., and Shanghai BioGerm Medical Co., Ltd. The different target genes (Table 1) produced typical S-shaped amplification curves, indicating that the RNA could be used in the 6 kits to evaluate their LoDs. Characteristics and limits of detection of six approved SARS-CoV-2 RT–PCR kits. The 6 commercial kits have been approved by NMPA, and 4 have received CE marking (Liferiver, Huada, DAAN, and Sansure). The web links for the 6 approved kits are Liferiver, http://www.liferiverbiotech.com/; Huada, https://www.bgi.com/us/; GeneoDx, http://www.geneodx.com/; DAAN, http://en.daangene.com/; Sansure, http://eng.sansure.com.cn/; and BioGerm, http://bio-germ.com/. All kits detected the viral RNA on the ABI 7500 Real-Time PCR System (Thermo Fisher Scientific). Characteristics and limits of detection of six approved SARS-CoV-2 RT–PCR kits. The 6 commercial kits have been approved by NMPA, and 4 have received CE marking (Liferiver, Huada, DAAN, and Sansure). The web links for the 6 approved kits are Liferiver, http://www.liferiverbiotech.com/; Huada, https://www.bgi.com/us/; GeneoDx, http://www.geneodx.com/; DAAN, http://en.daangene.com/; Sansure, http://eng.sansure.com.cn/; and BioGerm, http://bio-germ.com/. All kits detected the viral RNA on the ABI 7500 Real-Time PCR System (Thermo Fisher Scientific). The viral RNA concentration was determined with RT–droplet digital PCR (RT–ddPCR), which allows the absolute quantification of viral RNA by counting single molecules, without reference to an external standard curve. The RT–ddPCR primers and probes were designed to target ORF1ab, N gene, and E gene (5). ORF1ab-F: CCCTGTGGGTTTTACACTTAA, ORF1ab-R: ACGATTGTGCATCAGCTGA, ORF1ab-P: FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1; N-F: GGGGAACTTCTCCTGCTAGAAT, N-R: CAGACATTTTGCTCTCAAGCTG, N-P: FAM-TTGCTGCTGCTTGACAGATT-TAMRA; E-F: ACAGGTACGTTAATAGTTAATAGCGT, E-R: ATATTGCAGCAGTACGCACACA, N-P: FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ. The 20 μL reaction mixture contained 5 μL of One-Step RT–ddPCR Supermix (Bio-Rad), 2 μL of One-Step RT–ddPCR reverse transcriptase (Bio-Rad), 1 μL of 300 mmol/L DTT (Bio-Rad), 1 μL of mixed primers and probe (600 nmol/L primers and 200 nmol/L probe), 5 μL of 7.6 ng/μL RNA template, and 6 μL of RNase-free water. Each reaction mix was analyzed with the QX ONE Droplet Digital PCR (ddPCR) System (Bio-Rad). The thermal cycling conditions were: 45 °C for 10 min (reverse transcription) and 95 °C for 5 min; and 40 cycles of 95 °C for 15 s and 58 °C for 30 s. The average concentrations of ORF1ab, N gene, and E gene were 4.16 × 105, 5.33 × 105, and 5.04 × 105 copies/mL respectively, so the average concentration of viral RNA was 4.84 × 105 copies/mL. The serially two-fold diluted viral RNA was detected 20 times for each concentration. Following guidelines in the Clinical Laboratory Standards Institute (CLSI) document EP17-A, the lowest concentration level with a detection rate of 95% for positive results was taken as the LoD for each kit. The LoDs of 4 of the kits were 484 copies/mL, whereas the LoD of BioGerm was 968 copies/mL, and the LoD of GeneoDx was only 7744 copies/mL, giving a maximum 16-fold difference (Table 1). The poor LoD of the latter may be attributable to technical deficiencies in the product’s manufacture, including unreasonable primer design, primer or probe impurities, reagent instability, or inappropriate reagent ratios. The low sensitivity of the kit implies that it may fail to identify many COVID-19 patients who consequently would be unlikely to receive appropriate treatment in time, hindering the prevention and control of the epidemic. Our results show that the LoDs of the 6 commercial kits approved by NMPA differ substantially, with the poorest LoDs likely leading to false-negative results when RT–PCR is used to detect SARS-CoV-2 infection. Manufacturers should analyze the existing problems according to the clinical application and further improve their products. Laboratories should verify and compare the performances between kits from different manufacturers and different batches before their routine use. Such measures should help to reduce the clinical risks associated with false-negative results and more effectively control the spread of COVID-19 throughout the world. All authors confirmed they have contributed to the intellectual content of this paper and have met the following 4 requirements: (a) significant contributions to the conception and design, acquisition of data, or analysis and interpretation of data; (b) drafting or revising the article for intellectual content; (c) final approval of the published article; and (d) agreement to be accountable for all aspects of the article thus ensuring that questions related to the accuracy or integrity of any part of the article are appropriately investigated and resolved. Upon manuscript submission, all authors completed the author disclosure form. Disclosures and/or potential conflicts of interest: Employment or Leadership: None declared. Consultant or Advisory Role: None declared. Stock Ownership: None declared. Honoraria: None declared. Research Funding: This work was supported by grants from the National Science and Technology Major Project for the Control and Prevention of Major Infectious Diseases in China (#2018ZX10711001 and #2018ZX10102001). Expert Testimony: None declared. Patents: None declared. We acknowledge the 6 manufacturers for providing the SARS-CoV-2 RT–PCR detection kits.