[Detection of herpes viral genome in corneal buttons of quiescet herpes simplex keratitis with polymerase chain reaction].

PURPOSE: Herpetic keratitis is one of the major cause of blindness. The recent reports have proposed that the herpetic viruses may persist in cornea but provided noconclusive evidence. This study is to determine whether the cornea is another latent site of herpes simplex virus. METHODS: 18 corneal buttons of patients with quiescent herpes simplex keratitis which had quited for at least three months (mean 3.7 years) and were obtained by corneal transplantation were detected using polymerase chain reaction (PCR). The sequences of the primers are: P15'CATCACCGACCCGGAGAGGGAC, P25'GGGCCAGGCGCTTGTTGGTGTA. RESULTS: The positive HSV DNA were found in 17 corneal buttons out of 18 cases. CONCLUSION: The HSV genomes are present in the cornea of quiescent herpetic keratitis, which suggest that the cornea may be another latent site of herpetic virus. The PCR is a simple, specific and sensitive way to detect HSV genomes in cornea.