Analysis of inducing MCF-7 cells apoptosis by adenovirus-mediated RNA interference of hTERT.

[Objective] To construct the recombinant adenovirus mediated shRNA to hTERT, and investigate the in- hibitory effects of the vector on the MCF-7 cells, so as to provide a new approach for the gene therapy for breast cancer which aim at inhibiting the telomerase activity. [Methods] An interference target sequence GGAAGAGUGUCUGGAGCAAGU which aimed at hTERT gene was designed and the shRNA expression recombinant adenovirus vector rAd-shRNA-hTERT was pack-aged in HEK293 cells. The rAd-shRNA-HK and rAd-EGFP were constructed by the same method to be control. After trans-fecting MCF-7 cells for 48h, FQ-PCR and Western-blotting test were performed to detect the the expression of hTERT in MCF-7 cells. The apoptosis status was detected by flow cytometer. [Results] The results of restrictive endonuclease analysis and the sequencing identification confirmed that the target sequence was inserted into the predicted site precisely and the recom- bining adenovirus vectors were successfully constructed.The results of FQ-PCR and Western-blooting showed that the expression of hTERT in rAd-shRNA-hTERT group was obviously decreased at 48 hours after transfection. the cell growth was choked back and induced cell apoptosis. [ Conclusion] Adenovirus-mediated RNA interference of hTERT can inhibit the expression of hTERT of MCF-7 cells.It may open a new approach to the use of RNAi as a new tool to study gene function in cancer cell lines, and may be developed to be a new gene therapitic agent for cancer.