2010•Xiandai yufang yixueRequires access

Analysis of inducing MCF-7 cells apoptosis by adenovirus-mediated RNA interference of hTERT.

Lan Liu, Shaokun Chen, Qing-Lin Shui

Open publisher page 0 citations

Abstract

[Objective] To construct the recombinant adenovirus mediated shRNA to hTERT, and investigate the in- hibitory effects of the vector on the MCF-7 cells, so as to provide a new approach for the gene therapy for breast cancer which aim at inhibiting the telomerase activity. [Methods] An interference target sequence GGAAGAGUGUCUGGAGCAAGU which aimed at hTERT gene was designed and the shRNA expression recombinant adenovirus vector rAd-shRNA-hTERT was pack-aged in HEK293 cells. The rAd-shRNA-HK and rAd-EGFP were constructed by the same method to be control. After trans-fecting MCF-7 cells for 48h, FQ-PCR and Western-blotting test were performed to detect the the expression of hTERT in MCF-7 cells. The apoptosis status was detected by flow cytometer. [Results] The results of restrictive endonuclease analysis and the sequencing identification confirmed that the target sequence was inserted into the predicted site precisely and the recom- bining adenovirus vectors were successfully constructed.The results of FQ-PCR and Western-blooting showed that the expression of hTERT in rAd-shRNA-hTERT group was obviously decreased at 48 hours after transfection. the cell growth was choked back and induced cell apoptosis. [ Conclusion] Adenovirus-mediated RNA interference of hTERT can inhibit the expression of hTERT of MCF-7 cells.It may open a new approach to the use of RNAi as a new tool to study gene function in cancer cell lines, and may be developed to be a new gene therapitic agent for cancer.

About this research paper

What this paper is about

[Objective] To construct the recombinant adenovirus mediated shRNA to hTERT, and investigate the in- hibitory effects of the vector on the MCF-7 cells, so as to provide a new approach for the gene therapy for breast cancer which aim at inhibiting the telomerase activity. [Methods] An interference target sequence GGAAGAGUGUCUGGAGCAAGU which aimed at hTERT gene was designed and the shRNA expression recombinant adenovirus vector rAd-shRNA-hTERT was pack-aged in HEK293 cells. The rAd-shRNA-HK and rAd-EGFP were constructed by the same method to be control. After trans-fecting MCF-7 cells for 48h, FQ-PCR and Western-blotting test were performed to detect the the expression of hTERT in MCF-7 cells. The apoptosis status was detected by flow cytometer. [Results] The results of restrictive endonuclease analysis and the sequencing identification confirmed that the target sequence was inserted into the predicted site precisely and the recom- bining adenovirus vectors were successfully constructed.The results of FQ-PCR and Western-blooting showed that the expression of hTERT in rAd-shRNA-hTERT group was obviously decreased at 48 hours after transfection. the cell growth was choked back and induced cell apoptosis. [ Conclusion] Adenovirus-mediated RNA interference of hTERT can inhibit the expression of hTERT of MCF-7 cells.It may open a new approach to the use of RNAi as a new tool to study gene function in cancer cell lines, and may be developed to be a new gene therapitic agent for cancer.

Why it matters

A significance statement is not available in the OpenAlex record.

Key contribution

A contribution statement is not available in the OpenAlex record.

Method / approach

Method details are not available in the OpenAlex metadata.

Main findings

Findings are not separately available in the OpenAlex metadata.

Limitations

Limitations are not available in the OpenAlex metadata.

Applications

Application details are not available in the OpenAlex metadata.

Available abstract

[Objective] To construct the recombinant adenovirus mediated shRNA to hTERT, and investigate the in- hibitory effects of the vector on the MCF-7 cells, so as to provide a new approach for the gene therapy for breast cancer which aim at inhibiting the telomerase activity. [Methods] An interference target sequence GGAAGAGUGUCUGGAGCAAGU which aimed at hTERT gene was designed and the shRNA expression recombinant adenovirus vector rAd-shRNA-hTERT was pack-aged in HEK293 cells. The rAd-shRNA-HK and rAd-EGFP were constructed by the same method to be control. After trans-fecting MCF-7 cells for 48h, FQ-PCR and Western-blotting test were performed to detect the the expression of hTERT in MCF-7 cells. The apoptosis status was detected by flow cytometer. [Results] The results of restrictive endonuclease analysis and the sequencing identification confirmed that the target sequence was inserted into the predicted site precisely and the recom- bining adenovirus vectors were successfully constructed.The results of FQ-PCR and Western-blooting showed that the expression of hTERT in rAd-shRNA-hTERT group was obviously decreased at 48 hours after transfection. the cell growth was choked back and induced cell apoptosis. [ Conclusion] Adenovirus-mediated RNA interference of hTERT can inhibit the expression of hTERT of MCF-7 cells.It may open a new approach to the use of RNAi as a new tool to study gene function in cancer cell lines, and may be developed to be a new gene therapitic agent for cancer.

Key concepts: Telomerase reverse transcriptase, Small hairpin RNA, RNA interference, Transfection, Molecular biology, Viral vector, Biology, HEK 293 cells

Related papers

Back to paper searchBrowse research topicsOriginal source
Analysis of inducing MCF-7 cells apoptosis by adenovirus-mediated RNA interference of hTERT. — Research Paper | ScholarLens