ScholarLens Back to search
1981•Nucleic Acids ResearchOpen access

The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Izumi Kumagai, Martin Digweed, Volker A. Erdmann, Kimitsuna Watanabe, Tairo Oshima

Open full text 15 citations

Abstract

Using 3'- and 5'-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.

Open-access reader

About this research paper

What this paper is about

Using 3'- and 5'-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.

Why it matters

OpenAlex reports 15 citations for this work. Citation counts describe recorded attention and do not establish research quality.

Key contribution

A contribution statement is not available in the OpenAlex record.

Method / approach

Method details are not available in the OpenAlex metadata.

Main findings

Findings are not separately available in the OpenAlex metadata.

Limitations

Limitations are not available in the OpenAlex metadata.

Applications

Application details are not available in the OpenAlex metadata.

Available abstract

Using 3'- and 5'-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.

Key concepts: Thermus thermophilus, Biology, Thermus, Thermophile, Genetics, Nucleic acid sequence, Nucleotide, Sequence (biology)

Related papers

Related paper 1Related paper 2Related paper 3
Back to paper searchBrowse research topicsOriginal source
The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8 — Research Paper | ScholarLens