Role of base pairing partner on DNA‐protein crosslinking from guanine oxidation
Zitadel Anne Perez, Amanda Madison, Eric D. A. Stemp
Abstract
Zitadel Anne Perez, Amanda Madison, Eric D. A. Stemp
Abstract
Oxidative DNA damage contributes to aging, cancer, and other degenerative diseases. Guanine is particularly vulnerable to oxidation, creating radicals which form irreversible crosslinks to proteins. Here, we investigate how the reactivity of the guanine radical in the oligonucleotide 5′‐ATATGATATGGATATGATAT‐3′ depends on its base pairing partner(s). We synthesized DNA duplexes with cytosine derivatives or mismatches across from guanine. Guanine radicals were created photochemically and the DNA was analyzed by gel shift experiments. In the study of mismatches, the duplexes contained mismatches across from the 5′‐G of the GG doublet. Under both nondenaturing and denaturing conditions, crosslinking decreased in the order of G:G > G:A > G:T = G:C. The enhanced reactivity for the G:G and G:A mismatches is attributed to a lowered oxidation potential near the GG doublet. Cytosine derivatives crosslinked in the order of 5‐bromocytosine > cytosine > 5‐methylcytosine. These results are consistent with the presence of more of the more reactive radical cation with the 5‐bromocytosine, since it is a weaker base than cytosine or 5‐methylcytosine; melting temperature experiments indicated minimal differences between duplexes with the different cytosines. These results show that the reactivity of guanine in oxidative DNA‐protein crosslinking reactions depends on its base pairing partner.
A significance statement is not available in the OpenAlex record.
A contribution statement is not available in the OpenAlex record.
Method details are not available in the OpenAlex metadata.
Findings are not separately available in the OpenAlex metadata.
Limitations are not available in the OpenAlex metadata.
Application details are not available in the OpenAlex metadata.
Oxidative DNA damage contributes to aging, cancer, and other degenerative diseases. Guanine is particularly vulnerable to oxidation, creating radicals which form irreversible crosslinks to proteins. Here, we investigate how the reactivity of the guanine radical in the oligonucleotide 5′‐ATATGATATGGATATGATAT‐3′ depends on its base pairing partner(s). We synthesized DNA duplexes with cytosine derivatives or mismatches across from guanine. Guanine radicals were created photochemically and the DNA was analyzed by gel shift experiments. In the study of mismatches, the duplexes contained mismatches across from the 5′‐G of the GG doublet. Under both nondenaturing and denaturing conditions, crosslinking decreased in the order of G:G > G:A > G:T = G:C. The enhanced reactivity for the G:G and G:A mismatches is attributed to a lowered oxidation potential near the GG doublet. Cytosine derivatives crosslinked in the order of 5‐bromocytosine > cytosine > 5‐methylcytosine. These results are consistent with the presence of more of the more reactive radical cation with the 5‐bromocytosine, since it is a weaker base than cytosine or 5‐methylcytosine; melting temperature experiments indicated minimal differences between duplexes with the different cytosines. These results show that the reactivity of guanine in oxidative DNA‐protein crosslinking reactions depends on its base pairing partner.
Key concepts: Guanine, Cytosine, Chemistry, DNA, Oligonucleotide, Radical, Base pair, Reactivity (psychology)